bio fetch: download data

We have implemented the bio fetch command to facilitate data download from GenBank, Ensembl and other sources. If you need additional functionality beyond of what bio fetch offers see the end of the page for a list of alternatives. Install bio with:

pip install bio --upgrade

The full documentation for bio is maintained at https://www.bioinfo.help/.

Rationale

bio fetch was written to provide simpler data access. As in most cases the accession numbers uniquely define the data type bio fetch can automatically resolve the correct destination and will download data in the most appropriate format. Examples:

# Obtains nucleotidedata from GenBank
bio fetch NC_045512

# Obtains protein data from GenBank
bio fetch YP_009724390

# Obtains SRR run information from the Short Read Archive
bio fetch SRR1972976

# Obtains FASTA sequence files from Ensembl
bio fetch ENSG00000157764

# Obtain the coding sequence segments of a transcript
bio fetch ENST00000288602 --type cds | head

Read on for more details.

Fetch data from GenBank

To get a Genbank nucleotides by accession number run:

# Obtains nucleotidedata from GenBank
bio fetch NC_045512 | head

The default format is GenBank. You may also list multiple accession numbers at once:

# Obtains mulitple entries from GenBank
bio fetch NC_045512 MN996532 > genomes.gb

you may also fetch FASTA and GFF data directly from GenBank. The command

bio fetch NC_045512 --format fasta  | head -3

returns a FASTA file:

>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA
CGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAAC

whereas:

bio fetch NC_045512 --format gff  | head -3

returns a GFF file:

##sequence-region NC_045512.2 1 29903
##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=2697049
NC_045512.2 RefSeq  region  1   29903   .   +   .   ID=NC_045512.2:1..29903;Dbxref=taxon:2697049;collection-date=Dec-2019;country=China;gb-acronym=SARS-CoV-2;gbkey=Src;genome=genomic;isolate=Wuhan-Hu-1;mol_type=genomic RNA;nat-host=Homo sapiens;old-name=Wuhan seafood market pneumonia virus

Fetching genome assemblies

Genome assemblies at NCBI are also accessible with:

# Produces a GenBank file
bio search GCA_000006155

# Produces a FASTA file
bio search GCA_000006155 --format fasta

# Produces a GFF file.
bio search GCA_000006155 --format gff

Fetch data from Ensembl

bio fetch recognizes Ensemble accessions (ENSG, ENST) and will automatically connect to the Ensembl REST API:

# Ensenble gene
bio fetch ENSG00000157764 | head

# Transcript data in genomic context
bio fetch ENST00000288602  | head

# Transcript data as CDNA
bio fetch ENST00000288602 --type cdna | head

# Transcript data as CDS
bio fetch ENST00000288602 --type cds | head

# Transcript data as protein
bio fetch ENST00000288602 --type protein | head

These commands fetch data in FASTA formats. For more information see the Ensembl REST API:

And the enaBrowserTools: interface with the ENA web services to download data from ENA

Tools with similar utility

bio fetch is primarily a convenience function that simplifies the use of Entrez and ENA in certain simple and well defined cases.

See also the related tools that may have expanded functionality:

From https://www.biostars.org/p/9492531/#9492581 use the ENA portal API

# Get information
curl -X GET "https://www.ebi.ac.uk/ena/portal/api/filereport?accession=PRJNA374918&fields=run_accession,library_name,library_layout,fastq_ftp&result=read_run"

# What fields are acceptable
curl -X GET "https://www.ebi.ac.uk/ena/portal/api/returnFields?dataPortal=ena&result=read_run"